Recombinant Human Fxyd Domain-Containing Ion Transport Regulator 3 (FXYD3) Protein (His-SUMO)

Name: Recombinant Human Fxyd Domain-Containing Ion Transport Regulator 3 (FXYD3) Protein (His-SUMO)
Brand: Beta LifeScience
SKU: BLC-03790P
Availability: InStock

Greater than 85% as determined by SDS-PAGE.

Collections: High-quality recombinant proteins, Other recombinant proteins

Our products are highly customizable to meet your specific needs. You can choose options such as endotoxin removal, liquid or lyophilized forms, preferred tags, and the desired functional sequence range for proteins. Submitting a written inquiry expedites the quoting process.

Submit an inquiry today to inquire about all available size options and prices! Connect with us via the live chat in the bottom corner to receive immediate assistance.

Product Overview

Description	Recombinant Human Fxyd Domain-Containing Ion Transport Regulator 3 (FXYD3) Protein (His-SUMO) is produced by our E.coli expression system. This is a protein fragment.
Purity	Greater than 85% as determined by SDS-PAGE.
Uniprotkb	Q14802
Target Symbol	FXYD3
Synonyms	Chloride conductance inducer protein Mat 8; Chloride conductance inducer protein Mat-8; FXYD domain containing ion transport regulator 3; FXYD domain-containing ion transport regulator 3; Fxyd3; FXYD3_HUMAN; Mammary tumor 8 kDa protein; MAT-8; MAT8; MGC111076; Phospholemman like; Phospholemman-like; PLML
Species	Homo sapiens (Human)
Expression System	E.coli
Tag	N-6His-SUMO
Target Protein Sequence	AATGACCTAGAAGATAAAAACAGTCCTTTCTACTATGACTGGCACAGCCTCCAG
Expression Range	21-38aa
Protein Length	Partial
Mol. Weight	20.5 kDa
Research Area	Cancer
Form	Liquid or Lyophilized powder
Buffer	Liquid form: default storage buffer is Tris/PBS-based buffer, 5%-50% glycerol. Lyophilized powder form: the buffer before lyophilization is Tris/PBS-based buffer, 6% Trehalose, pH 8.0.
Reconstitution	Briefly centrifuged the vial prior to opening to bring the contents to the bottom. Reconstitute protein in deionized sterile water to a concentration of 0.1-1.0 mg/mL. It is recommended to add 5-50% of glycerol (final concentration) and aliquot for long-term storage at -20°C/-80°C. The default final concentration of glycerol is 50%.
Storage	1. Store at -20°C/-80°C upon receipt, aliquoting is necessary for mutiple use. 2. Avoid repeated freeze-thaw cycles. 3. Store working aliquots at 4°C for up to one week. 4. In general, protein in liquid form is stable for up to 6 months at -20°C/-80°C. Protein in lyophilized powder form is stable for up to 12 months at -20°C/-80°C.
Notes	Repeated freezing and thawing is not recommended. Store working aliquots at 4°C for up to one week.

Target Details

Target Function	Associates with and regulates the activity of the sodium/potassium-transporting ATPase (NKA) which transports Na(+) out of the cell and K(+) into the cell. Reduces glutathionylation of the NKA beta-1 subunit ATP1B1, thus reversing glutathionylation-mediated inhibition of ATP1B1. Induces a hyperpolarization-activated chloride current when expressed in Xenopus oocytes.; Decreases the apparent K+ and Na+ affinity of the sodium/potassium-transporting ATPase over a large range of membrane potentials.; Decreases the apparent K+ affinity of the sodium/potassium-transporting ATPase only at slightly negative and positive membrane potentials and increases the apparent Na+ affinity over a large range of membrane potentials.
Subcellular Location	Cell membrane; Single-pass type I membrane protein.
Protein Families	FXYD family
Database References	HGNC: 4027 OMIM: 604996 KEGG: hsa:5349 STRING: 9606.ENSP00000389770 UniGene: PMID: 26740212 All three markers correlated significantly with regional lymph node metastasis: FXYD3 (p = 0.0110), S100A11 (p = 0.0071), and GSTM3 (p = 0.0173) in colon cancer lymphatic metastasis. PMID: 22430872 ExoS facilitates P. aeruginosa penetration through the intestinal epithelial barrier by binding to FXYD3 and thereby impairing the defense function of tight junctions against bacterial penetration. PMID: 20805335 Up-regulated expression of FXYD-3 protein may be involved in tumourgenesis and invasion of gastric adenocarcinoma. PMID: 20364041 FXYD3 expression is related to several biological variables including ras, p53, legumain and PCNA, and may be involved in the development of the relatively early stages of colorectal cancers PMID: 19955746 Upregulation of FXYD3 is associated with glioma. PMID: 20112499 inactivation of FXYD3 through a gene mutation or unknown mechanism could be one cause of the atypical shapes of cancer cells and play a potential role in the progression of lung cancer. PMID: 19893046 Results indicate that the human MAT-8 gene contains the potential to serve as a prostate cancer expression marker and that MAT-8 plays an important role in cellular growth of prostate carcinomas. PMID: 14654946 overexpression of FXYD3 in pancreatic cancer may contribute to the proliferative activity of this malignancy PMID: 16003754 analysis of two human FXYD3 isoforms that are differentially expressed in differentiated and non-differentiated cells with different functional properties PMID: 17077088 FXYD3 interacts with Na(+)-K(+)-Exchanging ATPase in colorectal neoplasms. PMID: 17409496 structures of the FXYD proteins (with emphasis on 1-4), as well as their dynamics and their associations with the lipid PMID: 18000745 FXYD3 silencing prevents proper regulation of Na,K-ATPase, which leads to perturbation of cellular Na+ and K+ homeostasis and changes in the expression of Na,K-ATPase isozymes, whose functional properties are incompatible with cell differentiation. PMID: 19109419 FXYD3a protein is highly expressed in breast cancers, and responsible for cancer cell proliferation. PMID: 19571376

FAQs

Please fill out the Online Inquiry form located on the product page. Key product information has been pre-populated. You may also email your questions and inquiry requests to sales1@betalifesci.com. We will do our best to get back to you within 4 business hours.

Feel free to use the Chat function to initiate a live chat. Our customer representative can provide you with a quote immediately.

Proteins are sensitive to heat, and freeze-drying can preserve the activity of the majority of proteins. It improves protein stability, extends storage time, and reduces shipping costs. However, freeze-drying can also lead to the loss of the active portion of the protein and cause aggregation and denaturation issues. Nonetheless, these adverse effects can be minimized by incorporating protective agents such as stabilizers, additives, and excipients, and by carefully controlling various lyophilization conditions.

Commonly used protectant include saccharides, polyols, polymers, surfactants, some proteins and amino acids etc. We usually add 8% (mass ratio by volume) of trehalose and mannitol as lyoprotectant. Trehalose can significantly prevent the alter of the protein secondary structure, the extension and aggregation of proteins during freeze-drying process; mannitol is also a universal applied protectant and fillers, which can reduce the aggregation of certain proteins after lyophilization.

Our protein products do not contain carrier protein or other additives (such as bovine serum albumin (BSA), human serum albumin (HSA) and sucrose, etc., and when lyophilized with the solution with the lowest salt content, they often cannot form A white grid structure, but a small amount of protein is deposited in the tube during the freeze-drying process, forming a thin or invisible transparent protein layer.

Reminder: Before opening the tube cap, we recommend that you quickly centrifuge for 20-30 seconds in a small centrifuge, so that the protein attached to the tube cap or the tube wall can be aggregated at the bottom of the tube. Our quality control procedures ensure that each tube contains the correct amount of protein, and although sometimes you can't see the protein powder, the amount of protein in the tube is still very precise.

To learn more about how to properly dissolve the lyophilized recombinant protein, please visit Lyophilization FAQs.